P-del (pTransluc-miR-145-2)
(Plasmid
#21500)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21500 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTransluc (Panomics)
- Backbone size w/o insert (bp) 4800
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name0.9 kb 5' of miR-145
-
SpeciesH. sapiens (human)
-
Insert Size (bp)900
-
Entrez GeneMIR145 (a.k.a. MIRN145, miR-145, miRNA145)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site Bgl Ii (not destroyed)
- 5′ sequencing primer ggtaccgagctcttacgcgt sequencing primer sequence (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P-del (pTransluc-miR-145-2) was a gift from Kenneth Kosik (Addgene plasmid # 21500 ; http://n2t.net/addgene:21500 ; RRID:Addgene_21500) -
For your References section:
MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Xu N, Papagiannakopoulos T, Pan G, Thomson JA, Kosik KS. Cell. 2009 May 15. 137(4):647-58. 10.1016/j.cell.2009.02.038 PubMed 19409607