pGL3-noSV40-humanEC1.45_min1-2_4XEboxMutant
(Plasmid
#215026)
-
PurposeFirefly luciferase enhancer reporter plasmid with minimal enhancer regions 1 and 2 (min1 and min2) from SOX9 enhancer cluster EC1.45 with E-boxes mutated
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215026 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL3-Promoter, GenBank: U47298.2
- Backbone size w/o insert (bp) 5016
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMinimal enhancer regions 1 and 2 (min1 and min2) from SOX9 enhancer cluster EC1.45 with E-boxes mutated
-
SpeciesH. sapiens (human)
-
Insert Size (bp)488
-
Mutation4X E-box mutations within Coordinator motifs
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer CGCTCTCCATCAAAACAAAACG
- 3′ sequencing primer GAGTTAGGGGCGGGATGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-noSV40-humanEC1.45_min1-2_4XEboxMutant was a gift from Joanna Wysocka (Addgene plasmid # 215026 ; http://n2t.net/addgene:215026 ; RRID:Addgene_215026) -
For your References section:
DNA-guided transcription factor cooperativity shapes face and limb mesenchyme. Kim S, Morgunova E, Naqvi S, Goovaerts S, Bader M, Koska M, Popov A, Luong C, Pogson A, Swigut T, Claes P, Taipale J, Wysocka J. Cell. 2024 Feb 1;187(3):692-711.e26. doi: 10.1016/j.cell.2023.12.032. Epub 2024 Jan 22. 10.1016/j.cell.2023.12.032 PubMed 38262408