CCND1 targeting gRNA
(Plasmid
#215153)
-
PurposeExpresses gRNA targeting CCND1 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215153 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx458 (Plasmid #48138)
-
Modifications to backboneTargeting CCND1.
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehSpCas9
-
Alt nameSpCas9-2A-GFP
-
Alt nameCas9
-
gRNA/shRNA sequenceCGCGTACCCCGATGCCAACC
-
SpeciesSynthetic
- Promoter Cbh
-
Tags
/ Fusion Proteins
- 3XFLAG (N terminal on insert)
- GFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer hU6-F
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CCND1 targeting gRNA was a gift from Michele Pagano (Addgene plasmid # 215153 ; http://n2t.net/addgene:215153 ; RRID:Addgene_215153) -
For your References section:
CDK-independent role of D-type cyclins in regulating DNA mismatch repair. Rona G, Miwatani-Minter B, Zhang Q, Goldberg HV, Kerzhnerman MA, Howard JB, Simoneschi D, Lane E, Hobbs JW, Sassani E, Wang AA, Keegan S, Laverty DJ, Piett CG, Pongor LS, Xu ML, Andrade J, Thomas A, Sicinski P, Askenazi M, Ueberheide B, Fenyo D, Nagel ZD, Pagano M. Mol Cell. 2024 Feb 29:S1097-2765(24)00129-1. doi: 10.1016/j.molcel.2024.02.010. 10.1016/j.molcel.2024.02.010 PubMed 38458201