Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CCND1 targeting gRNA
(Plasmid #215153)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 215153 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    px458 (Plasmid #48138)
  • Modifications to backbone
    Targeting CCND1.
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hSpCas9
  • Alt name
    SpCas9-2A-GFP
  • Alt name
    Cas9
  • gRNA/shRNA sequence
    CGCGTACCCCGATGCCAACC
  • Species
    Synthetic
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3XFLAG (N terminal on insert)
    • GFP (C terminal on insert)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CCND1 targeting gRNA was a gift from Michele Pagano (Addgene plasmid # 215153 ; http://n2t.net/addgene:215153 ; RRID:Addgene_215153)
  • For your References section:

    CDK-independent role of D-type cyclins in regulating DNA mismatch repair. Rona G, Miwatani-Minter B, Zhang Q, Goldberg HV, Kerzhnerman MA, Howard JB, Simoneschi D, Lane E, Hobbs JW, Sassani E, Wang AA, Keegan S, Laverty DJ, Piett CG, Pongor LS, Xu ML, Andrade J, Thomas A, Sicinski P, Askenazi M, Ueberheide B, Fenyo D, Nagel ZD, Pagano M. Mol Cell. 2024 Feb 29:S1097-2765(24)00129-1. doi: 10.1016/j.molcel.2024.02.010. 10.1016/j.molcel.2024.02.010 PubMed 38458201