Skip to main content

CCND1 targeting gRNA
(Plasmid #215153)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215153 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 215153-D50 50 μg of DNA in Tris buffer $495
DNA 215153-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    px458 (Plasmid #48138)
  • Modifications to backbone
    Targeting CCND1.
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hSpCas9
  • Alt name
    SpCas9-2A-GFP
  • Alt name
    Cas9
  • gRNA/shRNA sequence
    CGCGTACCCCGATGCCAACC
  • Species
    Synthetic
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3XFLAG (N terminal on insert)
    • GFP (C terminal on insert)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CCND1 targeting gRNA was a gift from Michele Pagano (Addgene plasmid # 215153 ; http://n2t.net/addgene:215153 ; RRID:Addgene_215153)
  • For your References section:

    CDK-independent role of D-type cyclins in regulating DNA mismatch repair. Rona G, Miwatani-Minter B, Zhang Q, Goldberg HV, Kerzhnerman MA, Howard JB, Simoneschi D, Lane E, Hobbs JW, Sassani E, Wang AA, Keegan S, Laverty DJ, Piett CG, Pongor LS, Xu ML, Andrade J, Thomas A, Sicinski P, Askenazi M, Ueberheide B, Fenyo D, Nagel ZD, Pagano M. Mol Cell. 2024 Feb 29:S1097-2765(24)00129-1. doi: 10.1016/j.molcel.2024.02.010. 10.1016/j.molcel.2024.02.010 PubMed 38458201