Skip to main content

Bo_NPTII:pATML:Gus_introns
(Plasmid #215183)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215183 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAGM8031
  • Backbone manufacturer
    Sylvestre Marillonnet
  • Backbone size w/o insert (bp) 5201
  • Total vector size (bp) 12305
  • Vector type
    Synthetic Biology
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Meristem layer1
  • Species
    Synthetic
  • Insert Size (bp)
    3443
  • GenBank ID
    AT4G21750
  • Promoter AtML1

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer GTGGTGTAAACAAATTGACGC
  • 3′ sequencing primer GGATAAACCTTTTCACGCCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: This plasmid contains a T to C nucleotide mutation in Meristem layer1. This mutation is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Bo_NPTII:pATML:Gus_introns was a gift from Penny Hundleby (Addgene plasmid # 215183 ; http://n2t.net/addgene:215183 ; RRID:Addgene_215183)
  • For your References section:

    A Promoter Collection for Cell-Targeted Analysis Within the Stomatal Complex. Nguyen TH, Krasauskas J, Nguyen TB, Noureen A, Smedley M, Christie JM, Harwood W, Blatt MR, Hundleby P. Plant Direct. 2025 Feb 12;9(2):e70045. doi: 10.1002/pld3.70045. eCollection 2025 Feb. 10.1002/pld3.70045 PubMed 39943924