Skip to main content

pMamCol1
(Plasmid #215184)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215184 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC57-mini-Kana-BsmBI free-terminator-T7 deleted
  • Backbone manufacturer
    GeneScript
  • Backbone size w/o insert (bp) 2200
  • Total vector size (bp) 14603
  • Vector type
    Mammalian Expression, Bacterial Expression, AAV, CRISPR, Synthetic Biology ; Recombinant Protein Expression
  • Selectable markers
    Hygromycin ; AausFP1 fluorescent protein for stable cell selection via FACS.

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    NEB advises growing the plasmid at 30 degrees Celsius for even higher transgene stability. This in our hands, has also resulted in higher plasmid yields. Can add 1 mM IPTG during clone selection to do Purple-White Screening of positive clones.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tsPurple
  • Alt name
    Tinsel Purple Chromoprotein
  • Species
    Synthetic; Actinia equina
  • Insert Size (bp)
    687
  • Promoter TetON 3G Bidirectional for Mammalian and Trc with Lac operator inbuilt for E. coli
  • Tag / Fusion Protein
    • SNAC-StrepII tag (C terminal on backbone)

Cloning Information

  • Cloning method Gene Synthesis
  • 5′ sequencing primer caccatggcgcaggtgt
  • 3′ sequencing primer tgtgtgtcggctcaccttcgg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Gene Synthesis

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Hygromycin cassette has been synthesized such that it works in Bacteria as well.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMamCol1 was a gift from Krishna Kishore Inampudi (Addgene plasmid # 215184 ; http://n2t.net/addgene:215184 ; RRID:Addgene_215184)