pMamCol1
(Plasmid
#215184)
-
PurposeAllows for stable expression of recombinant (tagged/untagged) proteins in AAVS1 locus of Human cells and transient Protein Expression in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215184 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57-mini-Kana-BsmBI free-terminator-T7 deleted
-
Backbone manufacturerGeneScript
- Backbone size w/o insert (bp) 2200
- Total vector size (bp) 14603
-
Vector typeMammalian Expression, Bacterial Expression, AAV, CRISPR, Synthetic Biology ; Recombinant Protein Expression
-
Selectable markersHygromycin ; AausFP1 fluorescent protein for stable cell selection via FACS.
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsNEB advises growing the plasmid at 30 degrees Celsius for even higher transgene stability. This in our hands, has also resulted in higher plasmid yields. Can add 1 mM IPTG during clone selection to do Purple-White Screening of positive clones.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametsPurple
-
Alt nameTinsel Purple Chromoprotein
-
SpeciesSynthetic; Actinia equina
-
Insert Size (bp)687
- Promoter TetON 3G Bidirectional for Mammalian and Trc with Lac operator inbuilt for E. coli
-
Tag
/ Fusion Protein
- SNAC-StrepII tag (C terminal on backbone)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer caccatggcgcaggtgt
- 3′ sequencing primer tgtgtgtcggctcaccttcgg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGene Synthesis
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Hygromycin cassette has been synthesized such that it works in Bacteria as well.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMamCol1 was a gift from Krishna Kishore Inampudi (Addgene plasmid # 215184 ; http://n2t.net/addgene:215184 ; RRID:Addgene_215184)