Hv_HPT:pEXPA1:Gus_introns
(Plasmid
#215194)
-
PurposeEvaluating guard cell specific promotors in Barley
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215194 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAGM8031
-
Backbone manufacturerSylvestre Marillonnet
- Backbone size w/o insert (bp) 5201
- Total vector size (bp) 1521
-
Vector typePlant Expression, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExpansin1
-
SpeciesSynthetic
-
Insert Size (bp)1521
-
GenBank IDAT1G69530
- Promoter AtEXPA1
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GTGGTGTAAACAAATTGACGC
- 3′ sequencing primer GGATAAACCTTTTCACGCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hv_HPT:pEXPA1:Gus_introns was a gift from Penny Hundleby (Addgene plasmid # 215194 ; http://n2t.net/addgene:215194 ; RRID:Addgene_215194) -
For your References section:
A Promoter Collection for Cell-Targeted Analysis Within the Stomatal Complex. Nguyen TH, Krasauskas J, Nguyen TB, Noureen A, Smedley M, Christie JM, Harwood W, Blatt MR, Hundleby P. Plant Direct. 2025 Feb 12;9(2):e70045. doi: 10.1002/pld3.70045. eCollection 2025 Feb. 10.1002/pld3.70045 PubMed 39943924