Skip to main content

shRNA_SMAD2_1
(Plasmid #215204)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215204 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SMAD2 shRNA 1
  • gRNA/shRNA sequence
    GAACAAACCAGGTCTCTTGAT
  • Species
    H. sapiens (human)
  • Entrez Gene
    SMAD2 (a.k.a. CHTD8, JV18, JV18-1, LDS6, MADH2, MADR2, hMAD-2, hSMAD2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shRNA_SMAD2_1 was a gift from Sefi Rosenbluh (Addgene plasmid # 215204 ; http://n2t.net/addgene:215204 ; RRID:Addgene_215204)
  • For your References section:

    Systematic loss-of-function screens identify pathway-specific functional circular RNAs. Liu L, Neve M, Perlaza-Jimenez L, Xi X, Purcell J, Hawdon A, Conn SJ, Zenker J, Tamayo P, Goodall GJ, Rosenbluh J. Nat Cell Biol. 2024 Aug;26(8):1359-1372. doi: 10.1038/s41556-024-01467-y. Epub 2024 Aug 2. 10.1038/s41556-024-01467-y PubMed 39095657