Skip to main content

pX552 EF1a DIO Chronos GFP_Vgat gRNA
(Plasmid #215277)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215277 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pX552
  • Total vector size (bp) 7143
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Vgat gRNA
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (destroyed during cloning)
  • 3′ cloning site SapI (destroyed during cloning)
  • 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA
  • 3′ sequencing primer GATGCTTGGATCAAAATAGGAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.10.10.561249 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX552 EF1a DIO Chronos GFP_Vgat gRNA was a gift from Bryan Copits (Addgene plasmid # 215277 ; http://n2t.net/addgene:215277 ; RRID:Addgene_215277)
  • For your References section:

    Cell-Specific Single Viral Vector CRISPR/Cas9 Editing and Genetically Encoded Tool Delivery in the Central and Peripheral Nervous Systems. Moffa JC, Bland IN, Tooley JR, Kalyanaraman V, Heitmeier M, Creed MC, Copits BA. eNeuro. 2024 Jul 5;11(7):ENEURO.0438-23.2024. doi: 10.1523/ENEURO.0438-23.2024. Print 2024 Jul. 10.1523/ENEURO.0438-23.2024 PubMed 38871457