Skip to main content

131-2a_LC
(Plasmid #215331)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215331 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRK5
  • Backbone size w/o insert (bp) 5038
  • Total vector size (bp) 5752
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    131-2a_LC
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    714
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer GAAGAGGAAGAAAGGGAAAC
  • 3′ sequencing primer CTGTAATTGACAGCCTTGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.01.04.631317 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    131-2a_LC was a gift from Joost Snijder (Addgene plasmid # 215331 ; http://n2t.net/addgene:215331 ; RRID:Addgene_215331)
  • For your References section:

    Structural Basis for Postfusion-Specific Binding to the Respiratory Syncytial Virus F Protein by the Canonical Antigenic Site I Antibody 131-2a. Peng W, Siborova M, Wu X, Du W, Schulte D, Pronker MF, de Haan CAM, Snijder J. ACS Infect Dis. 2025 Aug 8;11(8):2357-2366. doi: 10.1021/acsinfecdis.5c00368. Epub 2025 Jul 22. 10.1021/acsinfecdis.5c00368 PubMed 40693554