pMVV207
(Plasmid
#215343)
-
PurposegRNA expression for S. stutzeri nifL deletion on an RSF1010 backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215343 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneRSF1010
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameS. stutzeri nifL gRNA
-
SpeciesSynthetic
-
Insert Size (bp)20
- Promoter J23119
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Other
- 5′ sequencing primer gcggttggcatagaggatgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMVV207 was a gift from Brian Pfleger (Addgene plasmid # 215343 ; http://n2t.net/addgene:215343 ; RRID:Addgene_215343) -
For your References section:
Synthetic Biology Toolbox for Nitrogen-Fixing Soil Microbes. Venkataraman M, Ynigez-Gutierrez A, Infante V, MacIntyre A, Fernandes-Junior PI, Ane JM, Pfleger B. ACS Synth Biol. 2023 Dec 15;12(12):3623-3634. doi: 10.1021/acssynbio.3c00414. Epub 2023 Nov 21. 10.1021/acssynbio.3c00414 PubMed 37988619