pLKO-U6-Letm1shRNA-hPGK-mTagBFP2
(Plasmid
#215363)
-
PurposeExpresses a rat Letm1 specific shRNA and a BFP under a separate hPGK promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1 - TRC
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLetm1 shRNA Target sequence
-
gRNA/shRNA sequenceCCTTCCAGAAATTGTGGCAAA
-
SpeciesR. norvegicus (rat)
-
Entrez GeneLetm1 (a.k.a. KHE)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-U6-Letm1shRNA-hPGK-mTagBFP2 was a gift from Jaime de Juan-Sanz (Addgene plasmid # 215363 ; http://n2t.net/addgene:215363 ; RRID:Addgene_215363) -
For your References section:
Mitochondrial Ca(2+) efflux controls neuronal metabolism and long-term memory across species. Amrapali Vishwanath A, Comyn T, Mira RG, Brossier C, Pascual-Caro C, Faour M, Boumendil K, Chintaluri C, Ramon-Duaso C, Fan R, Ghosh K, Farrants H, Berwick JP, Sivakumar R, Lopez-Manzaneda M, Schreiter ER, Preat T, Vogels TP, Rangaraju V, Busquets-Garcia A, Placais PY, Pavlowsky A, de Juan-Sanz J. Nat Metab. 2026 Feb 11. doi: 10.1038/s42255-026-01451-w. 10.1038/s42255-026-01451-w PubMed 41673453