Skip to main content
Addgene
Open Menu

pLKO-U6-Letm1shRNA-hPGK-miRFPnano
(Plasmid #215365)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215365 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pLKO.1 - TRC
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Letm1 shRNA Target sequence
  • gRNA/shRNA sequence
    CCTTCCAGAAATTGTGGCAAA
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Letm1 (a.k.a. KHE)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-U6-Letm1shRNA-hPGK-miRFPnano was a gift from Jaime de Juan-Sanz (Addgene plasmid # 215365 ; http://n2t.net/addgene:215365 ; RRID:Addgene_215365)

  • For your References section:

    Mitochondrial Ca(2+) efflux controls neuronal metabolism and long-term memory across species. Amrapali Vishwanath A, Comyn T, Mira RG, Brossier C, Pascual-Caro C, Faour M, Boumendil K, Chintaluri C, Ramon-Duaso C, Fan R, Ghosh K, Farrants H, Berwick JP, Sivakumar R, Lopez-Manzaneda M, Schreiter ER, Preat T, Vogels TP, Rangaraju V, Busquets-Garcia A, Placais PY, Pavlowsky A, de Juan-Sanz J. Nat Metab. 2026 Feb 11. doi: 10.1038/s42255-026-01451-w. 10.1038/s42255-026-01451-w PubMed 41673453
Related items: