pENTR2b-ITGB1(YYFF)-mRuby2
(Plasmid
#215447)
-
PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215447 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepENTR2b
-
Backbone manufacturerThermo Fisher Scientific Inc.
- Total vector size (bp) 5412
-
Vector typeGateway entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameITGB1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3120
-
MutationMutations in the NPxY sites Y783F, Y795F; Silent mutations added to disrupt shRNA binding aagainst endogenous ITGB1 between 2940-2960 bp (target seq: GCCTTGCATTACTGCTGATAT)
-
GenBank ID
-
Entrez GeneITGB1 (a.k.a. CD29, FNRB, GPIIA, MDF2, MSK12, VLA-BETA, VLAB)
- Promoter none
-
Tag
/ Fusion Protein
- mRuby2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer attL1_F
- 3′ sequencing primer attL2_R
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR2b-ITGB1(YYFF)-mRuby2 was a gift from Johanna Ivaska (Addgene plasmid # 215447 ; http://n2t.net/addgene:215447 ; RRID:Addgene_215447) -
For your References section:
Dynamic regulation of integrin beta1 phosphorylation supports invasion of breast cancer cells. Conway JRW, Joshi O, Kaivola J, Follain G, Gounis M, Kuhl D, Ivaska J. Nat Cell Biol. 2025 May 26. doi: 10.1038/s41556-025-01663-4. 10.1038/s41556-025-01663-4 PubMed 40419795