pPB.DEST-ITGB1(WT)-mRuby2
(Plasmid
#215448)
-
PurposePiggybac expression vector with integrin beta1 tagged with mRuby2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepPB.DEST
- Total vector size (bp) 8986
-
Vector typeMammalian Expression ; Transposon-based stable expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameITGB1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3120
-
MutationSilent mutations added to disrupt shRNA binding aagainst endogenous ITGB1 between 2940-2960 bp (target seq: GCCTTGCATTACTGCTGATAT)
-
GenBank IDNM_002211.4
-
Entrez GeneITGB1 (a.k.a. CD29, FNRB, GPIIA, MDF2, MSK12, VLA-BETA, VLAB)
- Promoter CAG
-
Tag
/ Fusion Protein
- mRuby2 (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAG_F
- 3′ sequencing primer BGH_R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB.DEST-ITGB1(WT)-mRuby2 was a gift from Johanna Ivaska (Addgene plasmid # 215448 ; http://n2t.net/addgene:215448 ; RRID:Addgene_215448) -
For your References section:
Dynamic regulation of integrin beta1 phosphorylation supports invasion of breast cancer cells. Conway JRW, Joshi O, Kaivola J, Follain G, Gounis M, Kuhl D, Ivaska J. Nat Cell Biol. 2025 May 26. doi: 10.1038/s41556-025-01663-4. 10.1038/s41556-025-01663-4 PubMed 40419795