Skip to main content
Addgene

pENTR2b-ITGB1(YYFF)
(Plasmid #215451)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 215451 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pENTR2b
  • Backbone manufacturer
    Thermo Fisher Scientific Inc.
  • Total vector size (bp) 4686
  • Vector type
    Gateway entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ITGB1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2394
  • Mutation
    Mutations in the NPxY sites Y783F, Y795F; Silent mutations added to disrupt shRNA binding aagainst endogenous ITGB1 between 2940-2960 bp (target seq: GCCTTGCATTACTGCTGATAT)
  • GenBank ID
  • Entrez Gene
    ITGB1 (a.k.a. CD29, FNRB, GPIIA, MDF2, MSK12, VLA-BETA, VLAB)
  • Promoter none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer attL1_F
  • 3′ sequencing primer attL2_R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR2b-ITGB1(YYFF) was a gift from Johanna Ivaska (Addgene plasmid # 215451 ; http://n2t.net/addgene:215451 ; RRID:Addgene_215451)
  • For your References section:

    Dynamic regulation of integrin beta1 phosphorylation supports invasion of breast cancer cells. Conway JRW, Joshi O, Kaivola J, Follain G, Gounis M, Kuhl D, Ivaska J. Nat Cell Biol. 2025 May 26. doi: 10.1038/s41556-025-01663-4. 10.1038/s41556-025-01663-4 PubMed 40419795