pDEST-ITGB1-V1
              
              
                (Plasmid
                
                #215454)
              
            
            
            
          - 
            PurposeExpression vector with integrin beta1 tagged with the BiFC V1 fragment
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215454 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
- 
            Vector backbonepDEST-ORF-V1
 - 
              Backbone manufacturerhttps://www.addgene.org/73637/
 - Total vector size (bp) 6226
 - 
              Vector typeMammalian Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameITGB1
 - 
                    SpeciesH. sapiens (human)
 - 
                  Insert Size (bp)2394
 - 
                  MutationSilent mutations added to disrupt shRNA binding aagainst endogenous ITGB1 between 2940-2960 bp (target seq: GCCTTGCATTACTGCTGATAT)
 - 
                    GenBank IDNM_002211.4
 - 
                        Entrez GeneITGB1 (a.k.a. CD29, FNRB, GPIIA, MDF2, MSK12, VLA-BETA, VLAB)
 - Promoter CMV
 - 
    
        Tag
        / Fusion Protein
    
- Venus fragment 1 (V1) (C terminal on backbone)
 
 
Cloning Information
- Cloning method Gateway Cloning
 - 5′ sequencing primer CMV_F
 - 3′ sequencing primer BGH_R (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pDEST-ITGB1-V1 was a gift from Johanna Ivaska (Addgene plasmid # 215454 ; http://n2t.net/addgene:215454 ; RRID:Addgene_215454) - 
                
For your References section:
Dynamic regulation of integrin beta1 phosphorylation supports invasion of breast cancer cells. Conway JRW, Joshi O, Kaivola J, Follain G, Gounis M, Kuhl D, Ivaska J. Nat Cell Biol. 2025 May 26. doi: 10.1038/s41556-025-01663-4. 10.1038/s41556-025-01663-4 PubMed 40419795