pSA358_pAAV-SCP1-Intron-eGFP-CS1
(Plasmid
#215513)
-
PurposeSingle stranded AAV eGFP reporter vector with SCP1 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215513 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 3468
- Total vector size (bp) 4600
-
Modifications to backboneAddition of a SCP1 promoter and chimeric intron
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeGFP
-
Insert Size (bp)720
- Promoter SCP1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tggactaagtttgttcgcatc
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSA358_pAAV-SCP1-Intron-eGFP-CS1 was a gift from Stein Aerts (Addgene plasmid # 215513 ; http://n2t.net/addgene:215513 ; RRID:Addgene_215513) -
For your References section:
Enhancer-driven cell type comparison reveals similarities between the mammalian and bird pallium. Hecker N, Kempynck N, Mauduit D, Abaffyova D, Vandepoel R, Dieltiens S, Borm L, Sarropoulos I, Gonzalez-Blas CB, De Man J, Davie K, Leysen E, Vandensteen J, Moors R, Hulselmans G, Lim L, De Wit J, Christiaens V, Poovathingal S, Aerts S. Science. 2025 Jan 2;387(6735):eadp3957. doi: 10.1126/science.adp3957. Epub 2025 Feb 14. 10.1126/science.adp3957 PubMed 39946451