Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

B2M-SDMutation-gRNA
(Plasmid #215547)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215547 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988)
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 62988)
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    B2M
  • gRNA/shRNA sequence
    GGGCACGCGTTTAATATAAG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    B2M (a.k.a. IMD43)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer LKO1.5: GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    B2M-SDMutation-gRNA was a gift from Kai Wang (Addgene plasmid # 215547 ; http://n2t.net/addgene:215547 ; RRID:Addgene_215547)
  • For your References section:

    Protocol for scarless genome editing of human pluripotent stem cell based on orthogonal selective reporters. Zhao Y, Pan Z, Hong Z, Sun M, Hong Y, Peng X, Li X, Wang X, Wang K. STAR Protoc. 2024 May 23;5(2):103084. doi: 10.1016/j.xpro.2024.103084. 10.1016/j.xpro.2024.103084 PubMed 38787727