B2M-SDMutation-gRNA
(Plasmid
#215547)
-
PurposegRNA targeting B2M to introduce splice donor mutation on the first intron of the locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988)
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 62988)
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameB2M
-
gRNA/shRNA sequenceGGGCACGCGTTTAATATAAG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneB2M (a.k.a. IMD43)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer LKO1.5: GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
B2M-SDMutation-gRNA was a gift from Kai Wang (Addgene plasmid # 215547 ; http://n2t.net/addgene:215547 ; RRID:Addgene_215547) -
For your References section:
Protocol for scarless genome editing of human pluripotent stem cell based on orthogonal selective reporters. Zhao Y, Pan Z, Hong Z, Sun M, Hong Y, Peng X, Li X, Wang X, Wang K. STAR Protoc. 2024 May 23;5(2):103084. doi: 10.1016/j.xpro.2024.103084. 10.1016/j.xpro.2024.103084 PubMed 38787727