pCMJ074
(Plasmid
#215654)
-
PurposepET28b derived T7 promoter with a 5’-UTR transcriptional fusion to clac143
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215654 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMB1
- Backbone size w/o insert (bp) 6500
- Total vector size (bp) 7354
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYellow fluorescent protein
-
Alt nameEYFP
-
Insert Size (bp)841
- Promoter T7
-
Tag
/ Fusion Protein
- 10x histidine tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcagcgacaccaaaccaag
- 3′ sequencing primer ccctcaagacccgtttagagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMJ074 was a gift from Brian Pfleger (Addgene plasmid # 215654 ; http://n2t.net/addgene:215654 ; RRID:Addgene_215654) -
For your References section:
Optimization of a T7-RNA polymerase system in Synechococcus sp. PCC 7002 mirrors the protein overproduction phenotype from E. coli BL21(DE3). Jones CM, Korosh TC, Nielsen DR, Pfleger BF. Appl Microbiol Biotechnol. 2021 Feb;105(3):1147-1158. doi: 10.1007/s00253-020-11085-x. Epub 2021 Jan 14. 10.1007/s00253-020-11085-x PubMed 33443634