Skip to main content

pCMJ074
(Plasmid #215654)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215654 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMB1
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 7354
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Yellow fluorescent protein
  • Alt name
    EYFP
  • Insert Size (bp)
    841
  • Promoter T7
  • Tag / Fusion Protein
    • 10x histidine tag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcagcgacaccaaaccaag
  • 3′ sequencing primer ccctcaagacccgtttagagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMJ074 was a gift from Brian Pfleger (Addgene plasmid # 215654 ; http://n2t.net/addgene:215654 ; RRID:Addgene_215654)
  • For your References section:

    Optimization of a T7-RNA polymerase system in Synechococcus sp. PCC 7002 mirrors the protein overproduction phenotype from E. coli BL21(DE3). Jones CM, Korosh TC, Nielsen DR, Pfleger BF. Appl Microbiol Biotechnol. 2021 Feb;105(3):1147-1158. doi: 10.1007/s00253-020-11085-x. Epub 2021 Jan 14. 10.1007/s00253-020-11085-x PubMed 33443634