pePEmax-pPuro
(Plasmid
#215688)
-
PurposeCloning vector for Uni-Vector prime editing system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215688 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPE3-pPuro
-
Vector typeUnspecified
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePEmax
-
Alt nameSV40_bpNLS-SpCas9(R221K,N394K,H840A)-SGGSx2-SV40_bpNLS-SGGSx2-MMLV_RT(D200N, T306K, W313F, T330P, L603W)-SV40_bpNLS-cMyc_NLS
-
SpeciesSynthetic; SpCas9 is from Streptococcus pyogenes; MMLV_RT is from the Moloney murine leukemia virus
-
Insert Size (bp)6306
- Promoter EFS promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe PEmax is subcloned from the pCMV-PEmax (addgene plasmid # 174820)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene QC NGS identifies discrepancies in the PuroR sequence. The depositing lab has confirmed that the plasmid should function as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pePEmax-pPuro was a gift from Kou-Juey Wu (Addgene plasmid # 215688 ; http://n2t.net/addgene:215688 ; RRID:Addgene_215688) -
For your References section:
A refined Uni-vector prime editing system improves genome editing outcomes in mammalian cells. Huang CH, Chiu SY, Chou YC, Wu KJ. Biotechnol J. 2024 Feb;19(2):e2300353. doi: 10.1002/biot.202300353. 10.1002/biot.202300353 PubMed 38403398