Skip to main content

pcDNAintron-LASV-GPC-c3xFLAG
(Plasmid #215689)

Ordering

Currently unavailable outside the U.S.
Item Catalog # Description Quantity Price (USD)
Plasmid 215689 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNAintron
  • Backbone size w/o insert (bp) 6205
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LASV GP-FLAG
  • Species
    Lassa virus - Josiah strain
  • Insert Size (bp)
    1541
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

codon optimized for mammalian expression; c-terminal FLAG tag dramatically reduces pseudo-particle (retroviral and VSV) titers. Recommend using untagged version to produce pseudo-particles.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNAintron-LASV-GPC-c3xFLAG was a gift from Melinda Brindley (Addgene plasmid # 215689 ; http://n2t.net/addgene:215689 ; RRID:Addgene_215689)
  • For your References section:

    Mutational Analysis of Lassa Virus Glycoprotein Highlights Regions Required for Alpha-Dystroglycan Utilization. Acciani M, Alston JT, Zhao G, Reynolds H, Ali AM, Xu B, Brindley MA. J Virol. 2017 Aug 24;91(18):e00574-17. doi: 10.1128/JVI.00574-17. Print 2017 Sep 15. 10.1128/JVI.00574-17 PubMed 28679759