Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNAintron-EBOV-GP
(Plasmid #215692)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 215692 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Currently unavailable outside the U.S.

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNAintron
  • Backbone size w/o insert (bp) 6205
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EBOV-GP
  • Species
    Ebola virus - Zaire strain
  • Insert Size (bp)
    2030
  • Promoter CMV

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNAintron-EBOV-GP was a gift from Melinda Brindley (Addgene plasmid # 215692 ; http://n2t.net/addgene:215692 ; RRID:Addgene_215692)
  • For your References section:

    Ebola Virus Requires Phosphatidylserine Scrambling Activity for Efficient Budding and Optimal Infectivity. Acciani MD, Lay Mendoza MF, Havranek KE, Duncan AM, Iyer H, Linn OL, Brindley MA. J Virol. 2021 Sep 27;95(20):e0116521. doi: 10.1128/JVI.01165-21. Epub 2021 Jul 28. 10.1128/JVI.01165-21 PubMed 34319156