pColdI-GST-mGTSF2
(Plasmid
#215714)
-
PurposeBacterial expression of GST-tagged GTSF2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215714 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepColdI-GST
-
Backbone manufacturerTakara
- Total vector size (bp) 5097
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGTSF2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)405
-
GenBank IDNM_177631.4
-
Entrez GeneGtsf2
- Promoter CspA
-
Tags
/ Fusion Proteins
- GST (N terminal on backbone)
- 6x His (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acgccatatcgccgaaagg
- 3′ sequencing primer ggcagggatcttagattctg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pColdI-GST-mGTSF2 was a gift from Phillip Zamore (Addgene plasmid # 215714 ; http://n2t.net/addgene:215714 ; RRID:Addgene_215714) -
For your References section:
GTSF1 accelerates target RNA cleavage by PIWI-clade Argonaute proteins. Arif A, Bailey S, Izumi N, Anzelon TA, Ozata DM, Andersson C, Gainetdinov I, MacRae IJ, Tomari Y, Zamore PD. Nature. 2022 Aug;608(7923):618-625. doi: 10.1038/s41586-022-05009-0. Epub 2022 Jun 30. 10.1038/s41586-022-05009-0 PubMed 35772669