MCP-YPet
(Plasmid
#215747)
-
PurposeExpresses MS2 coat protein (MCP) fused to YPet
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215747 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE-EFS-MCP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameYPet
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer accgtatataagtgcagtagtcgc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe pHAGE-EFS-MCP-HALOnls plasmid was a gift from Thoru Pederson (Addgene plasmid # 121937; RRID:Addgene_121937). The pcDNA3-Cyto-CaNAR2 plasmid containing the YPet fluorophore was a gift from Jin Zhang (Addgene plasmid # 64729; RRID:Addgene_64729).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MCP-YPet was a gift from Albert Jeltsch (Addgene plasmid # 215747 ; http://n2t.net/addgene:215747 ; RRID:Addgene_215747) -
For your References section:
Modular dual-color BiAD sensors for locus-specific readout of epigenome modifications in single cells. Kohler AR, Hausser J, Harsch A, Bernhardt S, Haussermann L, Brenner LM, Lungu C, Olayioye MA, Bashtrykov P, Jeltsch A. Cell Rep Methods. 2024 Mar 26:100739. doi: 10.1016/j.crmeth.2024.100739. 10.1016/j.crmeth.2024.100739 PubMed 38554702