pUC19-HDRT-CD3z-truncCAR(anti-CD19)
(Plasmid
#215758)
-
PurposeHDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215758 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneUC19
- Backbone size w/o insert (bp) 2769
- Total vector size (bp) 4911
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This sequence encodes a CD3-zeta-deficient CD19-CAR (truncCD19-CAR) for Homology-Dependent Repair (HDR)-mediated in-frame integration into the second exon of the gene CD247 (CD3-zeta) of primary human T cells. This integration approach produces fusion genes comprising the transgenic, exogenously delivered truncated CAR and the endogenous CD3-zeta gene, resulting in the translation of a full-length CD19-CAR protein. The sequence is derived from the CD19-CAR that was previously used for TRAC-integration (addgene ID: 183473, Kath et al, 2022, doi: https://doi.org/10.1016/j.omtm.2022.03.018)
Use indicated primer pair for amplification of HDR-templates:
Forward Primer: atctgctcgccttgtttccac
Reverse Primer: cctctgcctgagtgtaagccc
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-HDRT-CD3z-truncCAR(anti-CD19) was a gift from Dimitrios Wagner (Addgene plasmid # 215758 ; http://n2t.net/addgene:215758 ; RRID:Addgene_215758) -
For your References section:
Integration of zeta-deficient CARs into the CD3-zeta gene conveys potent cytotoxicity in T and NK cells. Kath J, Franke C, Drosdek V, Du W, Glaser V, Fuster-Garcia C, Stein M, Zittel T, Schulenberg S, Porter CE, Andersch L, Kunkele A, Alcaniz J, Hoffmann J, Abken H, Abou-El-Enein M, Pruss A, Suzuki M, Cathomen T, Stripecke R, Volk HD, Reinke P, Schmueck-Henneresse M, Wagner DL. Blood. 2024 Mar 17:blood.2023020973. doi: 10.1182/blood.2023020973. 10.1182/blood.2023020973 PubMed 38493479