Skip to main content
Addgene

pUC19-HDRT-CD3z-truncCARgsg(anti-CD19)
(Plasmid #215759)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215759 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTwist
  • Backbone manufacturer
    Twist Bioscience
  • Backbone size w/o insert (bp) 2221
  • Total vector size (bp) 4452
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CD247-truncCD19CAR-GSG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2231
  • Entrez Gene
    CD19 (a.k.a. B4, CVID3)
  • Entrez Gene
    CD247 (a.k.a. CD3-ZETA, CD3H, CD3Q, CD3Z, CD3ZETA, IMD25, T3Z, TCRZ)
  • Tag / Fusion Protein
    • IgG1 CH3

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACTTTGCTGCTTACCGCAGC
  • 3′ sequencing primer TGGCCCCGGATTTTCCTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This sequence encodes a CD3-zeta-deficient CD19-CAR (truncCD19-CAR) for Homology-Dependent Repair (HDR)-mediated in-frame integration into the second exon of the gene CD247 (CD3-zeta) of primary human T cells. It contains an additional GSG-linker in front of the P2A-sequence for high CAR expression. This integration approach produces fusion genes comprising the transgenic, exogenously delivered truncated CAR and the endogenous CD3-zeta gene, resulting in the translation of a full-length CD19-CAR protein. The sequence is derived from the CD19-CAR that was previously used for TRAC-integration (addgene ID: 183473, Kath et al, 2022, doi: https://doi.org/10.1016/j.omtm.2022.03.018)

Use indicated primer pair for amplification of HDR-templates:
Forward Primer: atctgctcgccttgtttccac
Reverse Primer: cctctgcctgagtgtaagccc

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-HDRT-CD3z-truncCARgsg(anti-CD19) was a gift from Dimitrios Wagner (Addgene plasmid # 215759 ; http://n2t.net/addgene:215759 ; RRID:Addgene_215759)
  • For your References section:

    Integration of zeta-deficient CARs into the CD3-zeta gene conveys potent cytotoxicity in T and NK cells. Kath J, Franke C, Drosdek V, Du W, Glaser V, Fuster-Garcia C, Stein M, Zittel T, Schulenberg S, Porter CE, Andersch L, Kunkele A, Alcaniz J, Hoffmann J, Abken H, Abou-El-Enein M, Pruss A, Suzuki M, Cathomen T, Stripecke R, Volk HD, Reinke P, Schmueck-Henneresse M, Wagner DL. Blood. 2024 Mar 17:blood.2023020973. doi: 10.1182/blood.2023020973. 10.1182/blood.2023020973 PubMed 38493479