pBH501
(Plasmid
#215780)
-
PurposeNBU1 backbone with constitutive dCas9
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215780 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneNBU1 (R6K/RP4)
-
Vector typeBacterial Expression, Synthetic Biology
-
Selectable markersTetracycline (Bacteroides)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9
-
Insert Size (bp)4107
- Promoter P1
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GATGTAACGCACTGAGAAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBH501 was a gift from Corey Wilson (Addgene plasmid # 215780 ; http://n2t.net/addgene:215780 ; RRID:Addgene_215780) -
For your References section:
Transcriptional programming in a Bacteroides consortium. Huang BD, Groseclose TM, Wilson CJ. Nat Commun. 2022 Jul 6;13(1):3901. doi: 10.1038/s41467-022-31614-8. 10.1038/s41467-022-31614-8 PubMed 35794179