pBH502
(Plasmid
#215781)
-
PurposeNBU2 backbone with LacI(YQR) and P(O1)_sgRNA targeting Nanoluc
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215781 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneNBU2 (R6K/RP4)
-
Vector typeBacterial Expression, Synthetic Biology
-
Selectable markersErythromycin (Bacteroides)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLacI(YQR)
-
Insert Size (bp)1083
- Promoter Bt1311
Cloning Information for Gene/Insert 1
- Cloning method Golden Gate
- 5′ sequencing primer ctaattgcctatcttccagtgatg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA-ribozyme cassette
-
Insert Size (bp)213
- Promoter P(O1)
Cloning Information for Gene/Insert 2
- Cloning method Golden Gate
- 5′ sequencing primer GATGTAACGCACTGAGAAGC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameNanoluc
-
Insert Size (bp)516
- Promoter cfxA
Cloning Information for Gene/Insert 3
- Cloning method Golden Gate
- 5′ sequencing primer AGCGGTCGGTTCGGAAATAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBH502 was a gift from Corey Wilson (Addgene plasmid # 215781 ; http://n2t.net/addgene:215781 ; RRID:Addgene_215781) -
For your References section:
Transcriptional programming in a Bacteroides consortium. Huang BD, Groseclose TM, Wilson CJ. Nat Commun. 2022 Jul 6;13(1):3901. doi: 10.1038/s41467-022-31614-8. 10.1038/s41467-022-31614-8 PubMed 35794179