Skip to main content
Addgene

AA233
(Plasmid #215941)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 215941 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Cloning Grade DNA 215941-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $110

Backbone

  • Vector backbone
    pUC57-Kan
  • Vector type
    CRISPR ; Fragment

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    U6_v1; sgCD274_v1 [Sp]; trRNA_v14 [Sp]
  • gRNA/shRNA sequence
    CTATACACAGCTTTATTCCT
  • Species
    Streptococcus pyogenes

Cloning Information

  • Cloning method Unknown

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Genscript ID: U024JHB230-39

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Information for Cloning Grade DNA (Catalog # 215941-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $110 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AA233 was a gift from John Doench (Addgene plasmid # 215941 ; http://n2t.net/addgene:215941 ; RRID:Addgene_215941)
  • For your References section:

    Modular vector assembly enables rapid assessment of emerging CRISPR technologies. McGee AV, Liu YV, Griffith AL, Szegletes ZM, Wen B, Kraus C, Miller NW, Steger RJ, Escude Velasco B, Bosch JA, Zirin JD, Viswanatha R, Sontheimer EJ, Goodale A, Greene MA, Green TM, Doench JG. Cell Genom. 2024 Mar 13;4(3):100519. doi: 10.1016/j.xgen.2024.100519. 10.1016/j.xgen.2024.100519 PubMed 38484704