AA290
(Plasmid
#215949)
-
PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surface
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215949 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Cloning Grade DNA | 215949-DNA.cg | 2 µg of cloning grade DNA in Tris buffer | 1 | $110 |
Backbone
-
Vector backbonepUC57-Kan
-
Vector typeCRISPR ; Fragment
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameU6_v1; sgCD55_v4; trRNA_v4 [Sp]
-
gRNA/shRNA sequenceTTAGAACAAGGACGCGCCGC
-
SpeciesStreptococcus pyogenes
Cloning Information
- Cloning method Unknown
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGenscript ID: U912JHE170-30
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint.
Information for Cloning Grade DNA (Catalog # 215949-DNA.cg) ( Back to top)
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $110 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AA290 was a gift from John Doench (Addgene plasmid # 215949 ; http://n2t.net/addgene:215949 ; RRID:Addgene_215949) -
For your References section:
Modular vector assembly enables rapid assessment of emerging CRISPR technologies. McGee AV, Liu YV, Griffith AL, Szegletes ZM, Wen B, Kraus C, Miller NW, Steger RJ, Escude Velasco B, Bosch JA, Zirin JD, Viswanatha R, Sontheimer EJ, Goodale A, Greene MA, Green TM, Doench JG. Cell Genom. 2024 Mar 13;4(3):100519. doi: 10.1016/j.xgen.2024.100519. 10.1016/j.xgen.2024.100519 PubMed 38484704