Skip to main content

pRDB_131
(Plasmid #216095)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216095 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRDA_722
  • Vector type
    Lentiviral, CRISPR ; Positive Controls

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CD97, CD4, CD26, CD274 guides
  • gRNA/shRNA sequence
    accgaaggtcaggaaagtccaac; aaagcaggttgcacttcattctt; actttgacatgttccctgagagc; gctaagagggagcagggtccccg
  • Species
    Other

Cloning Information

  • Cloning method Unknown

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRDB_131 was a gift from John Doench (Addgene plasmid # 216095 ; http://n2t.net/addgene:216095 ; RRID:Addgene_216095)
  • For your References section:

    Modular vector assembly enables rapid assessment of emerging CRISPR technologies. McGee AV, Liu YV, Griffith AL, Szegletes ZM, Wen B, Kraus C, Miller NW, Steger RJ, Escude Velasco B, Bosch JA, Zirin JD, Viswanatha R, Sontheimer EJ, Goodale A, Greene MA, Green TM, Doench JG. Cell Genom. 2024 Mar 13;4(3):100519. doi: 10.1016/j.xgen.2024.100519. 10.1016/j.xgen.2024.100519 PubMed 38484704