pYHY3
(Plasmid
#216109)
-
PurposeaTC-inducible expression of secretory BT3630 SP-NanoLuc via P1TDP-A21 promoter-RBS pair in Bacteroides species.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216109 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYHY1
- Total vector size (bp) 8402
-
Vector typeBacterial Expression, Synthetic Biology ; E. coli-Bacteroides shuttle vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAlso contains erythromycin for selection in Bacteroides species
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNanoLuc
- Promoter P1TDP-A21
-
Tags
/ Fusion Proteins
- 3xFLAG tag (C terminal on insert)
- BT3630 signal peptide (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtgtaaaagcgcagtactgcttg
- 3′ sequencing primer ggtaactgtcagaccaagtttactc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.12.14.571725v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYHY3 was a gift from Shannon Sirk (Addgene plasmid # 216109 ; http://n2t.net/addgene:216109 ; RRID:Addgene_216109) -
For your References section:
A molecular toolkit for heterologous protein secretion across Bacteroides species. Yeh YH, Kelly VW, Rahman Pour R, Sirk SJ. Nat Commun. 2024 Nov 11;15(1):9741. doi: 10.1038/s41467-024-53845-7. 10.1038/s41467-024-53845-7 PubMed 39528443