YIplac204-TDH3p-CDC19-CYC1t
(Plasmid
#216122)
-
PurposeYeast integrative vector for constitutive expression of CDC19 at the TRP1 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216122 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneYIplac204-TDH3p-CYC1t
-
Backbone manufacturerValeria Mapelli
- Backbone size w/o insert (bp) 4470
- Total vector size (bp) 5973
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePyruvate kinase 1
-
Alt nameCDC19
-
SpeciesS. cerevisiae (budding yeast); Saccharomyces cerevisiae
-
Insert Size (bp)1503
-
GenBank ID851193
- Promoter TDH3 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ACGGTAGGTATTGATTGTAATT
- 3′ sequencing primer ATAGGGACCTAGACTTCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YIplac204-TDH3p-CDC19-CYC1t was a gift from Yvonne Nygård (Addgene plasmid # 216122 ; http://n2t.net/addgene:216122 ; RRID:Addgene_216122) -
For your References section:
Engineering of Saccharomyces cerevisiae for enhanced metabolic robustness and L-lactic acid production from lignocellulosic biomass. Choi B, Tafur Rangel A, Kerkhoven EJ, Nygard Y. Metab Eng. 2024 Jul;84:23-33. doi: 10.1016/j.ymben.2024.05.003. Epub 2024 May 23. 10.1016/j.ymben.2024.05.003 PubMed 38788894