TDP-REGv2(mScarlet-FLAG)#7 in pTwist-CMV backbone
(Plasmid
#216152)
-
PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. This plasmid has one of the best dynamic ranges of those tested (~100-fold) in SK-N-BE2 cells. It uses a cryptic exon. [Code 'A11'] Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor Comments
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216152 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTwist CMV
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsMUST use stable bacterial line to avoid recombination of UG-rich region (e.g. Stbl3, NEB Stable)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemScarlet with cryptic exon and C-terminal FLAG
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTCTTGGTGCCAGCTTATCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.11.15.565967 for bioRxiv preprint.
Note: Due to the splicing of lentiviral RNAs prior to viral packaging, which may remove the alternatively-spliced regions of the TDP-REG sequences, we recommend using alternative systems that do not require a transcribed intermediate (transient transfection, AAV, piggybac or other DNA integrases or recombinases).
One approach described in the literature is to use reverse-complemented splicing minigene sequences in lentiviruses, preventing splicing before packaging (e.g. DOI: 10.1038/s41587-022-01224-2). However, this may cause additional issues, such as lowered titres (due to competing promoters on the reverse strand) or the pre-packaging splicing of unannotated splice sites that occur by random chance in the reverse complement sequence (we have observed this phenomenon via Nanopore sequencing of lentiviral RNA). As such, we are also hesitant to recommend this approach.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TDP-REGv2(mScarlet-FLAG)#7 in pTwist-CMV backbone was a gift from Pietro Fratta (Addgene plasmid # 216152 ; http://n2t.net/addgene:216152 ; RRID:Addgene_216152) -
For your References section:
Creation of de novo cryptic splicing for ALS and FTD precision medicine. Wilkins OG, Chien MZYJ, Wlaschin JJ, Barattucci S, Harley P, Mattedi F, Mehta PR, Pisliakova M, Ryadnov E, Keuss MJ, Thompson D, Digby H, Knez L, Simkin RL, Diaz JA, Zanovello M, Brown AL, Darbey A, Karda R, Fisher EMC, Cunningham TJ, Le Pichon CE, Ule J, Fratta P. Science. 2024 Oct 4;386(6717):61-69. doi: 10.1126/science.adk2539. Epub 2024 Oct 3. 10.1126/science.adk2539 PubMed 39361759