FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd
(Plasmid
#216172)
-
PurposeExpress the gRNA targeting the control site in the human ZEB2 locus for the CRISPRd experiment
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216172 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFgH1tUTG
-
Backbone manufacturerAddgene Plasmid #70183
- Backbone size w/o insert (bp) 10000
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA- Control- ZEB2.locus
-
gRNA/shRNA sequenceTCAGCTAACGGTGCAGCTAC
-
SpeciesH. sapiens (human)
-
Tag
/ Fusion Protein
- EGFP
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer N/A
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byIncorporates the use of Addgene 70183
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd was a gift from Makiko Iwafuchi (Addgene plasmid # 216172 ; http://n2t.net/addgene:216172 ; RRID:Addgene_216172) -
For your References section:
Pioneer and PRDM transcription factors coordinate bivalent epigenetic states to safeguard cell fate. Matsui S, Granitto M, Buckley M, Ludwig K, Koigi S, Shiley J, Zacharias WJ, Mayhew CN, Lim HW, Iwafuchi M. Mol Cell. 2024 Jan 4:S1097-2765(23)01026-2. doi: 10.1016/j.molcel.2023.12.007. 10.1016/j.molcel.2023.12.007 PubMed 38211589