Skip to main content

FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd
(Plasmid #216172)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216172 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FgH1tUTG
  • Backbone manufacturer
    Addgene Plasmid #70183
  • Backbone size w/o insert (bp) 10000
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA- Control- ZEB2.locus
  • gRNA/shRNA sequence
    TCAGCTAACGGTGCAGCTAC
  • Species
    H. sapiens (human)
  • Tag / Fusion Protein
    • EGFP

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Incorporates the use of Addgene 70183

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd was a gift from Makiko Iwafuchi (Addgene plasmid # 216172 ; http://n2t.net/addgene:216172 ; RRID:Addgene_216172)
  • For your References section:

    Pioneer and PRDM transcription factors coordinate bivalent epigenetic states to safeguard cell fate. Matsui S, Granitto M, Buckley M, Ludwig K, Koigi S, Shiley J, Zacharias WJ, Mayhew CN, Lim HW, Iwafuchi M. Mol Cell. 2024 Jan 4:S1097-2765(23)01026-2. doi: 10.1016/j.molcel.2023.12.007. 10.1016/j.molcel.2023.12.007 PubMed 38211589