B2387_mEGFP-FKBP2x
(Plasmid
#216216)
-
PurposeExpresses mEGFP(A206K) fused to FKBP-FKBP in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Colorado Denver and Anschutz Medical Campus
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216216 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 216216-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 216216-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneEGFPN1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemEGFP-FKBP-FKBP
-
Alt nameFKBP 1A
-
Alt namefk-506 binding protein 1A
-
SpeciesH. sapiens (human)
-
Entrez GeneFKBP1A (a.k.a. FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP(A206K)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer GGGCGTGGATAGCGGTTTGAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 216216-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 216216-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
B2387_mEGFP-FKBP2x was a gift from Chandra Tucker (Addgene plasmid # 216216 ; http://n2t.net/addgene:216216 ; RRID:Addgene_216216) -
For your References section:
A platform to induce and mature biomolecular condensates using chemicals and light. Hernandez-Candia CN, Brady BR, Harrison E, Tucker CL. Nat Chem Biol. 2024 Jan 8. doi: 10.1038/s41589-023-01520-1. 10.1038/s41589-023-01520-1 PubMed 38191942
