Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

B2387_mEGFP-FKBP2x
(Plasmid #216216)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 216216 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    EGFPN1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mEGFP-FKBP-FKBP
  • Alt name
    FKBP 1A
  • Alt name
    fk-506 binding protein 1A
  • Species
    H. sapiens (human)
  • Entrez Gene
    FKBP1A (a.k.a. FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP(A206K)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer GGGCGTGGATAGCGGTTTGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    B2387_mEGFP-FKBP2x was a gift from Chandra Tucker (Addgene plasmid # 216216 ; http://n2t.net/addgene:216216 ; RRID:Addgene_216216)
  • For your References section:

    A platform to induce and mature biomolecular condensates using chemicals and light. Hernandez-Candia CN, Brady BR, Harrison E, Tucker CL. Nat Chem Biol. 2024 Jan 8. doi: 10.1038/s41589-023-01520-1. 10.1038/s41589-023-01520-1 PubMed 38191942