Skip to main content

pET151-GyrB
(Plasmid #216233)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216233 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET101
  • Backbone manufacturer
    Thermo
  • Backbone size w/o insert (bp) 5800
  • Total vector size (bp) 7689
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DNA gyrase
  • Alt name
    gyrB
  • Species
    S. aureus
  • Insert Size (bp)
    1932
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET151-GyrB was a gift from Eric Brown (Addgene plasmid # 216233 ; http://n2t.net/addgene:216233 ; RRID:Addgene_216233)
  • For your References section:

    A platform for predicting mechanism of action based on bacterial transcriptional responses identifies an unusual DNA gyrase inhibitor. French S, Guo ABY, Ellis MJ, Deisinger JP, Johnson JW, Rachwalski K, Piquette ZA, Lluka T, Zary M, Gamage S, Magolan J, Brown ED. Cell Rep. 2024 Apr 4;43(4):114053. doi: 10.1016/j.celrep.2024.114053. 10.1016/j.celrep.2024.114053 PubMed 38578824