G1088E_pLenti-CMV-mNeonGreen-2A-HygroR
(Plasmid
#216279)
-
PurposeGreen and hygromycin resistant lentiviral vector plasmid for multiplexed receptor pseudovirus experiments
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216279 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti
-
Vector typeLentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemNeonGreen-2A-Hpt
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
G1088E_pLenti-CMV-mNeonGreen-2A-HygroR was a gift from Kenneth Matreyek (Addgene plasmid # 216279 ; http://n2t.net/addgene:216279 ; RRID:Addgene_216279) -
For your References section:
Pseudotyped virus infection of multiplexed ACE2 libraries reveals SARS-CoV-2 variant shifts in receptor usage. Shukla N, Roelle SM, Snell JC, DelSignore O, Bruchez AM, Matreyek KA. PLoS Pathog. 2024 May 20;20(5):e1012044. doi: 10.1371/journal.ppat.1012044. 10.1371/journal.ppat.1012044 PubMed 38768238