pSARGENT1
(Plasmid
#216315)
-
PurposeReporter cassette for SARGENT with piggyBac ITRs and 10x Capture Sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneNA
- Backbone size w/o insert (bp) 1785
- Total vector size (bp) 6589
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametagBFP
-
SpeciesSynthetic
-
Insert Size (bp)702
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACCAAAATCAACGGGACTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSARGENT1 was a gift from Barak Cohen (Addgene plasmid # 216315 ; http://n2t.net/addgene:216315 ; RRID:Addgene_216315)