pAAV2.1-CMV-5'Cer-BDlacZ-bGHpA
(Plasmid
#216318)
-
PurposeSplit fluorophore assay to test reconstitution via mRNA trans-splicing (REVeRT system).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216318 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV2.1
- Total vector size (bp) 4305
-
Modifications to backboneLeft ITR is truncated
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesplit cerulean fluorescent protein + splice donor site
-
SpeciesSynthetic
-
Insert Size (bp)310
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer gggaggggcaaacaacagatggc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV2.1-CMV-5'Cer-BDlacZ-bGHpA was a gift from Elvir Becirovic (Addgene plasmid # 216318 ; http://n2t.net/addgene:216318 ; RRID:Addgene_216318) -
For your References section:
mRNA trans-splicing dual AAV vectors for (epi)genome editing and gene therapy. Riedmayr LM, Hinrichsmeyer KS, Thalhammer SB, Mittas DM, Karguth N, Otify DY, Bohm S, Weber VJ, Bartoschek MD, Splith V, Brummer M, Ferreira R, Boon N, Wogenstein GM, Grimm C, Wijnholds J, Mehlfeld V, Michalakis S, Fenske S, Biel M, Becirovic E. Nat Commun. 2023 Oct 18;14(1):6578. doi: 10.1038/s41467-023-42386-0. 10.1038/s41467-023-42386-0 PubMed 37852949