Skip to main content

pAAV-CMVenh synapsin-intron-mCherry-1x miR7 Rn ATP10B
(Plasmid #216392)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216392 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Wilson
  • Backbone size w/o insert (bp) 5154
  • Total vector size (bp) 5865
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mcherry and miR Rn ATP10B
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    845
  • Promoter CMVenh synapsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GGTTACAAGACAGGTTTAAGGAG
  • 3′ sequencing primer caacgggccacaactcctc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMVenh synapsin-intron-mCherry-1x miR7 Rn ATP10B was a gift from Veerle Baekelandt (Addgene plasmid # 216392 ; http://n2t.net/addgene:216392 ; RRID:Addgene_216392)
  • For your References section:

    Loss of the lysosomal lipid flippase ATP10B leads to progressive dopaminergic neurodegeneration and parkinsonian motor deficits. Sanchiz-Calvo M, Coccia E, Cawthorne C, Morrone Parfitt G, Torre-Muruzabal T, Tsafaras G, Van Laere K, Cabezudo D, Cascalho A, Van den Haute C, Vangheluwe P, Blanchard J, Bentea E, Baekelandt V. Acta Neuropathol. 2025 Jul 17;150(1):5. doi: 10.1007/s00401-025-02908-0. 10.1007/s00401-025-02908-0 PubMed 40676227