pAAV-CMVenh synapsin-intron-mCherry-1x miR7 Rn ATP10B
(Plasmid
#216392)
-
Purposetransfer plasmid for AAV vector production of mCherry and miR for rat Rn ATP10B
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216392 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerWilson
- Backbone size w/o insert (bp) 5154
- Total vector size (bp) 5865
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemcherry and miR Rn ATP10B
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)845
- Promoter CMVenh synapsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GGTTACAAGACAGGTTTAAGGAG
- 3′ sequencing primer caacgggccacaactcctc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMVenh synapsin-intron-mCherry-1x miR7 Rn ATP10B was a gift from Veerle Baekelandt (Addgene plasmid # 216392 ; http://n2t.net/addgene:216392 ; RRID:Addgene_216392) -
For your References section:
Loss of the lysosomal lipid flippase ATP10B leads to progressive dopaminergic neurodegeneration and parkinsonian motor deficits. Sanchiz-Calvo M, Coccia E, Cawthorne C, Morrone Parfitt G, Torre-Muruzabal T, Tsafaras G, Van Laere K, Cabezudo D, Cascalho A, Van den Haute C, Vangheluwe P, Blanchard J, Bentea E, Baekelandt V. Acta Neuropathol. 2025 Jul 17;150(1):5. doi: 10.1007/s00401-025-02908-0. 10.1007/s00401-025-02908-0 PubMed 40676227