p2702-AGER-gRNA1
(Plasmid
#216471)
-
Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start site
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216471 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX458
-
Backbone manufacturerMorrissey Laboratory
- Backbone size w/o insert (bp) 9274
- Total vector size (bp) 9292
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting human AGER locus
-
gRNA/shRNA sequencecaccgccaggctccaactgctgttc
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer n/a
- 3′ sequencing primer n/a
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.01.19.524655v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2702-AGER-gRNA1 was a gift from Darrell Kotton (Addgene plasmid # 216471 ; http://n2t.net/addgene:216471 ; RRID:Addgene_216471) -
For your References section:
Generation of human alveolar epithelial type I cells from pluripotent stem cells. Burgess CL, Huang J, Bawa PS, Alysandratos KD, Minakin K, Ayers LJ, Morley MP, Babu A, Villacorta-Martin C, Yampolskaya M, Hinds A, Thapa BR, Wang F, Matschulat A, Mehta P, Morrisey EE, Varelas X, Kotton DN. Cell Stem Cell. 2024 Apr 15:S1934-5909(24)00098-5. doi: 10.1016/j.stem.2024.03.017. 10.1016/j.stem.2024.03.017 PubMed 38642558