Skip to main content

p2702-AGER-gRNA1
(Plasmid #216471)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216471 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX458
  • Backbone manufacturer
    Morrissey Laboratory
  • Backbone size w/o insert (bp) 9274
  • Total vector size (bp) 9292
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting human AGER locus
  • gRNA/shRNA sequence
    caccgccaggctccaactgctgttc
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2702-AGER-gRNA1 was a gift from Darrell Kotton (Addgene plasmid # 216471 ; http://n2t.net/addgene:216471 ; RRID:Addgene_216471)
  • For your References section:

    Generation of human alveolar epithelial type I cells from pluripotent stem cells. Burgess CL, Huang J, Bawa PS, Alysandratos KD, Minakin K, Ayers LJ, Morley MP, Babu A, Villacorta-Martin C, Yampolskaya M, Hinds A, Thapa BR, Wang F, Matschulat A, Mehta P, Morrisey EE, Varelas X, Kotton DN. Cell Stem Cell. 2024 Apr 15:S1934-5909(24)00098-5. doi: 10.1016/j.stem.2024.03.017. 10.1016/j.stem.2024.03.017 PubMed 38642558