pU6-sgRNA_MET_uORF1
(Plasmid
#216537)
-
PurposegRNA and template for MET 5'UTR uORF1 mutation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216537 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepU6
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepegRNA MET 5'UTR uORF1 mutation
-
gRNA/shRNA sequenceCCAGTGACTCAGCCGGGCAT
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-sgRNA_MET_uORF1 was a gift from Paolo Comoglio (Addgene plasmid # 216537 ; http://n2t.net/addgene:216537 ; RRID:Addgene_216537) -
For your References section:
The integrated stress response drives MET oncogene overexpression in cancers. Cerqua M, Foiani M, Boccaccio C, Comoglio PM, Altintas DM. EMBO J. 2025 Jan 7. doi: 10.1038/s44318-024-00338-4. 10.1038/s44318-024-00338-4 PubMed 39774381