pWZL-hygro-FAKY861F
(Plasmid
#216546)
-
PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: Y861F) of human PTK2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepWZL-Hygro
-
Backbone manufacturerJay Morgenstern
- Backbone size w/o insert (bp) 5642
- Total vector size (bp) 5642
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePTK2 (Y861F)
-
Alt nameFAK
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3243
-
MutationFAK dominant negative mutation Y861F
-
GenBank IDNP_005598.3
-
Entrez GenePTK2 (a.k.a. FADK, FADK 1, FAK, FAK1, FRNK, PPP1R71, p125FAK, pp125FAK)
-
Tag
/ Fusion Protein
- No
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pBABE 5'
- 3′ sequencing primer Custom designed oligo RV on backbone to sequence the mutation: TTTCCGGGCCCTCACATTGCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOrdered the mutant sequences from genscript and sub-cloned it to pWZL Hygro (Plasmid #18750).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWZL-hygro-FAKY861F was a gift from Georgia Konstantinidou (Addgene plasmid # 216546 ; http://n2t.net/addgene:216546 ; RRID:Addgene_216546) -
For your References section:
ERK5 suppression overcomes FAK inhibitor resistance in mutant KRAS-driven non-small cell lung cancer. Pozzato C, Outeiro-Pinho G, Galie M, Ramadori G, Konstantinidou G. EMBO Mol Med. 2024 Sep 13. doi: 10.1038/s44321-024-00138-7. 10.1038/s44321-024-00138-7 PubMed 39271958