pOP01-UTC-7.0
(Plasmid
#216625)
-
PurposeNanoLuc reporter plasmid to optimize chloroplast cell-free systems, universal test construct
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216625 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAmpR-ColE1
-
Backbone manufacturerJohn Dueber lab
- Total vector size (bp) 3110
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT7p-5'g10-NanoLuc-3'TMV
-
Alt namenluc
-
SpeciesSynthetic; Oplophorus gracilirostris
-
Insert Size (bp)519
- Promoter T7
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GCTCACATGTTCTTTCCTGC
- 3′ sequencing primer GGTAACTGTCAGACCAAGTTTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOP01-UTC-7.0 was a gift from Henrike Niederholtmeyer (Addgene plasmid # 216625 ; http://n2t.net/addgene:216625 ; RRID:Addgene_216625) -
For your References section:
Chloroplast Cell-Free Systems from Different Plant Species as a Rapid Prototyping Platform. Bohm CV, Inckemann R, Burgis M, Baumann J, Brinkmann CK, Lipinska KE, Gilles S, Freudigmann J, Seiler VN, Clark LG, Jewett MC, Voll LM, Niederholtmeyer H. ACS Synth Biol. 2024 Aug 16;13(8):2412-2424. doi: 10.1021/acssynbio.4c00117. Epub 2024 Jul 19. 10.1021/acssynbio.4c00117 PubMed 39028299