Skip to main content
Addgene

pWZL-hygro-FAKY397F
(Plasmid #216677)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216677 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pWZL-Hygro
  • Backbone manufacturer
    Jay Morgenstern
  • Backbone size w/o insert (bp) 5642
  • Total vector size (bp) 5642
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PTK2 (Y397F)
  • Alt name
    FAK
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3243
  • Mutation
    FAK dominant negative mutation Y397F
  • GenBank ID
    NP_005598.3
  • Entrez Gene
    PTK2 (a.k.a. FADK, FADK 1, FAK, FAK1, FRNK, PPP1R71, p125FAK, pp125FAK)
  • Tag / Fusion Protein
    • No

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer Custom designed to detect the mutated sequence: TTGCGGAGAATATGGCTGACC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Ordered the mutant sequences from genscript and sub-cloned it to pWZL Hygro (Plasmid #18750).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWZL-hygro-FAKY397F was a gift from Georgia Konstantinidou (Addgene plasmid # 216677 ; http://n2t.net/addgene:216677 ; RRID:Addgene_216677)
  • For your References section:

    ERK5 suppression overcomes FAK inhibitor resistance in mutant KRAS-driven non-small cell lung cancer. Pozzato C, Outeiro-Pinho G, Galie M, Ramadori G, Konstantinidou G. EMBO Mol Med. 2024 Sep 13. doi: 10.1038/s44321-024-00138-7. 10.1038/s44321-024-00138-7 PubMed 39271958