pYB-Dual(mNG(yeast-opt))
(Plasmid
#216727)
-
PurposeDual-species protein expression vector for high-level and inducible protein expression of mNeonGreen (codon optimized for yeast) in both yeast and bacteria from the same construct.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216727 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepYB-Dual
- Backbone size w/o insert (bp) 6932
- Total vector size (bp) 7643
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemNeonGreen
-
SpeciesSynthetic; Branchiostoma lanceolatum
-
Insert Size (bp)711
- Promoter pGAL1(yeast) and pT7-RNAP(bacteria)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer CTAATACTTTCAACATTTTCG
- 3′ sequencing primer CAGGCTTTACACTTTATGCTTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYB-Dual(mNG(yeast-opt)) was a gift from Emil Jensen (Addgene plasmid # 216727 ; http://n2t.net/addgene:216727 ; RRID:Addgene_216727) -
For your References section:
A strategy for successful dual-species protein expression of genes with non-optimal codon usage destined for bacterial and yeast cell factories. Waneskog M, Rasmussen TB, Jensen ED. Biotechnol Prog. 2024 May 17:e3482. doi: 10.1002/btpr.3482. 10.1002/btpr.3482 PubMed 38757558