Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pYB-Dual(mNG(yeast-opt))
(Plasmid #216727)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 216727 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pYB-Dual
  • Backbone size w/o insert (bp) 6932
  • Total vector size (bp) 7643
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mNeonGreen
  • Species
    Synthetic; Branchiostoma lanceolatum
  • Insert Size (bp)
    711
  • Promoter pGAL1(yeast) and pT7-RNAP(bacteria)

Cloning Information

  • Cloning method Gene Synthesis
  • 5′ sequencing primer CTAATACTTTCAACATTTTCG
  • 3′ sequencing primer CAGGCTTTACACTTTATGCTTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYB-Dual(mNG(yeast-opt)) was a gift from Emil Jensen (Addgene plasmid # 216727 ; http://n2t.net/addgene:216727 ; RRID:Addgene_216727)
  • For your References section:

    A strategy for successful dual-species protein expression of genes with non-optimal codon usage destined for bacterial and yeast cell factories. Waneskog M, Rasmussen TB, Jensen ED. Biotechnol Prog. 2024 May 17:e3482. doi: 10.1002/btpr.3482. 10.1002/btpr.3482 PubMed 38757558