pCAX-SCLM
(Plasmid
#216757)
-
PurposeFor strong and long-lasting expression of SuperClomeleon in mammalian cells from the hybrid CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAX
- Backbone size w/o insert (bp) 4287
- Total vector size (bp) 5682
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuperClomeleon
-
Alt nameCerulean/S30R/dC11-LE-Topaz/dN5/S30R/Q69T/V163A
-
SpeciesA. victoria (crystal jelly)
-
Insert Size (bp)1395
-
MutationS30R and 11 AA deletion in the Cerulean CFP moiety and 5 AA deletion, S30R, Q69T, and V163A in the Topaz YFP moiety
- Promoter CAG (cytomegalovirus-chicken beta-actin-rabbit beta-globin)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer tgctggttattgtgctgtctcatc
- 3′ sequencing primer ATATGTTGCCAAACTCTAAACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAX-SCLM was a gift from George Augustine (Addgene plasmid # 216757 ; http://n2t.net/addgene:216757 ; RRID:Addgene_216757)